../../tmp/servers/virsirnadb/1048374799
Result for your query siRNA sequence
RED | =100 % Complementary sequence |
. | =Identical residue |
blue alphabets | =mismatch |
_ | =Gap |
Acc number | Strain name | Start | Alignment | End | % Identity |
Query | virsi2317 | 1 | tggcgagggacattaaggcgt | 21 | |
AY112987.1 | Semliki forest virus strain L10, complete genome | 7303 | ..................... | 7323 | 100 |
AY112987.1 | Semliki forest virus strain L10, complete genome | 1271 | _.........atac.....__ | 1288 | 66 |
AY112987.1 | Semliki forest virus strain L10, complete genome | 7987 | ___.........c..______ | 7998 | 52 |
DQ189082.1 | Semliki forest virus isolate ts10 mutant polyprotein nsP1234 and stru | 7220 | ..................... | 7240 | 100 |
DQ189082.1 | Semliki forest virus isolate ts10 mutant polyprotein nsP1234 and stru | 1185 | _.........atac.....__ | 1202 | 66 |
DQ189082.1 | Semliki forest virus isolate ts10 mutant polyprotein nsP1234 and stru | 7904 | ___.........c..______ | 7915 | 52 |
DQ189084.1 | Semliki forest virus isolate ts13 mutant polyprotein nsP1234 and stru | 7220 | ..................... | 7240 | 100 |
DQ189084.1 | Semliki forest virus isolate ts13 mutant polyprotein nsP1234 and stru | 1185 | _.........atac.....__ | 1202 | 66 |
DQ189084.1 | Semliki forest virus isolate ts13 mutant polyprotein nsP1234 and stru | 7904 | ___.........c..______ | 7915 | 52 |
DQ189086.1 | Semliki forest virus polyprotein nsP1234 and structural polyprotein g | 7220 | ..................... | 7240 | 100 |
DQ189086.1 | Semliki forest virus polyprotein nsP1234 and structural polyprotein g | 1185 | _.........atac.....__ | 1202 | 66 |
DQ189086.1 | Semliki forest virus polyprotein nsP1234 and structural polyprotein g | 7904 | ___.........c..______ | 7915 | 52 |
EU350586.1 | Semliki forest virus from Viet Nam, complete genome | 7427 | ..................... | 7447 | 100 |
EU350586.1 | Semliki forest virus from Viet Nam, complete genome | 1392 | _.........atac.....__ | 1409 | 66 |
EU350586.1 | Semliki forest virus from Viet Nam, complete genome | 8111 | ___.........c..______ | 8122 | 52 |
NC_003215.1 | Semliki forest virus, complete genome | 7302 | ..................... | 7322 | 100 |
NC_003215.1 | Semliki forest virus, complete genome | 1270 | _.........atac.....__ | 1287 | 66 |
NC_003215.1 | Semliki forest virus, complete genome | 7986 | ___.........c..______ | 7997 | 52 |
Z48163.2 | Semliki forest virus genomic RNA for non-structural polyprotein and s | 7284 | ....a................ | 7304 | 95 |
Z48163.2 | Semliki forest virus genomic RNA for non-structural polyprotein and s | 1270 | _.........ata......__ | 1287 | 71 |
Z48163.2 | Semliki forest virus genomic RNA for non-structural polyprotein and s | 7968 | ___.........c..______ | 7979 | 52 |