Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for gE are 1
Results from 0 - 25
siRNA sequence "aauauacgaaucgugucugua" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Herpes Simplex Virus [HSV]" virus
Browse "virsi1908 " record
Length: 21
GC Content:33 %
Starting position: 155351
Strain of Virus: HSV-1 Strain 17
GenBank Acc: FJ593289
Transfection Reagent: Lipofectin
Incubation Time (Hours):72
Length: 21
GC Content:33 %
Starting position: 155351
Strain of Virus: HSV-1 Strain 17
GenBank Acc: FJ593289
Transfection Reagent: Lipofectin
Incubation Time (Hours):72
Offtargets for "aauauacgaaucgugucugua" siRNA in Human Genome sequences
See FJ593289 at Genbank
Pubmed:15367593
Article:Short interfering RNA-mediated inhibition of herpes simplex virus type 1 gene expression and function during infection of human keratinocytes.
Authors:Bhuyan PK, Karikò K, Capodici J, Lubinski J, Hook LM, Friedman HM, Weissman D.
Journal:J Virol. 2004 Oct;78(19):10276-81.
Entrez:15367593
Article:Short interfering RNA-mediated inhibition of herpes simplex virus type 1 gene expression and function during infection of human keratinocytes.
Authors:Bhuyan PK, Karikò K, Capodici J, Lubinski J, Hook LM, Friedman HM, Weissman D.
Journal:J Virol. 2004 Oct;78(19):10276-81.
Entrez:15367593
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1908 | aauauacgaaucgugucugua | Herpes Simplex Virus [HSV] |  SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm