VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for 15367593 are 1
Results from 0 - 25

siRNA sequence "aauauacgaaucgugucugua" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Herpes Simplex Virus [HSV]" virus
Browse "virsi1908 " record
Length: 21
GC Content:33 %
Starting position: 155351
Strain of Virus: HSV-1 Strain 17
GenBank Acc: FJ593289
Transfection Reagent: Lipofectin
Incubation Time (Hours):72

Offtargets for "aauauacgaaucgugucugua" siRNA in Human Genome sequences
See FJ593289 at Genbank
Pubmed:15367593
Article:Short interfering RNA-mediated inhibition of herpes simplex virus type 1 gene expression and function during infection of human keratinocytes.
Authors:Bhuyan PK, Karikò K, Capodici J, Lubinski J, Hook LM, Friedman HM, Weissman D.
Journal:J Virol. 2004 Oct;78(19):10276-81.
Entrez:15367593


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1908	aauauacgaaucgugucugua	Herpes Simplex Virus [HSV]	gE	HaCaT	Plaque Count	75	15367593	Blast SL	refseqs



: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm