VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for 16681752 are 4
Results from 0 - 25

siRNA sequence "uguguguacugcaagcaac" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "uguguguacugcaagcaac" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1720 " record
Length: 19
GC Content:47 %
Starting position: 191
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Genejammer
Incubation Time (Hours):14 Days

Offtargets for "uguguguacugcaagcaac" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16681752
Article:Extended effects of human papillomavirus 16 E6-specific short hairpin RNA on cervical carcinoma cells.
Authors:Bai L, Wei L, Wang J, Li X, He P.
Journal:Int J Gynecol Cancer. 2006 Mar-Apr;16(2):718-29.
Entrez:16681752

siRNA sequence "caguuacugcgacgugaggu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "caguuacugcgacgugaggu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1721 " record
Length: 20
GC Content:55 %
Starting position: 209
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Genejammer
Incubation Time (Hours):14 Days

Offtargets for "caguuacugcgacgugaggu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16681752
Article:Extended effects of human papillomavirus 16 E6-specific short hairpin RNA on cervical carcinoma cells.
Authors:Bai L, Wei L, Wang J, Li X, He P.
Journal:Int J Gynecol Cancer. 2006 Mar-Apr;16(2):718-29.
Entrez:16681752

siRNA sequence "accguugugugauuuguua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "accguugugugauuuguua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1722 " record
Length: 19
GC Content:37 %
Starting position: 385
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Genejammer
Incubation Time (Hours):14 Days

Offtargets for "accguugugugauuuguua" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16681752
Article:Extended effects of human papillomavirus 16 E6-specific short hairpin RNA on cervical carcinoma cells.
Authors:Bai L, Wei L, Wang J, Li X, He P.
Journal:Int J Gynecol Cancer. 2006 Mar-Apr;16(2):718-29.
Entrez:16681752

siRNA sequence "gcaaagacaucuggacaaa" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gcaaagacaucuggacaaa" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1723 " record
Length: 19
GC Content:42 %
Starting position: 448
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Genejammer
Incubation Time (Hours):14 Days

Offtargets for "gcaaagacaucuggacaaa" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16681752
Article:Extended effects of human papillomavirus 16 E6-specific short hairpin RNA on cervical carcinoma cells.
Authors:Bai L, Wei L, Wang J, Li X, He P.
Journal:Int J Gynecol Cancer. 2006 Mar-Apr;16(2):718-29.
Entrez:16681752


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1720	uguguguacugcaagcaac	Human Papillomavirus [HPV]	E6	SiHa	mRNA	90	16681752	Blast SL	refseqs
virsi1721	caguuacugcgacgugaggu	Human Papillomavirus [HPV]	E6	SiHa	mRNA	85	16681752	Blast SL	refseqs
virsi1722	accguugugugauuuguua	Human Papillomavirus [HPV]	E6	SiHa	mRNA	53	16681752	Blast SL	refseqs
virsi1723	gcaaagacaucuggacaaa	Human Papillomavirus [HPV]	E6	SiHa	mRNA	30	16681752	Blast SL	refseqs



: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm