Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for 20885450 are 9
Results from 0 - 25
siRNA sequence "cacgagcaauuaagcga" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cacgagcaauuaagcga" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1743 " record
Length: 17
GC Content:47 %
Starting position: 671
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 17
GC Content:47 %
Starting position: 671
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "cacgagcaauuaagcga" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450
siRNA sequence "ucucuacuguuaugagcaauua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ucucuacuguuaugagcaauua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1740 " record
Length: 22
GC Content:32 %
Starting position: 624
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 22
GC Content:32 %
Starting position: 624
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "ucucuacuguuaugagcaauua" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450
siRNA sequence "gcaaacaacuauacaugaua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gcaaacaacuauacaugaua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1736 " record
Length: 20
GC Content:30 %
Starting position: 160
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 20
GC Content:30 %
Starting position: 160
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "gcaaacaacuauacaugaua" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450
siRNA sequence "cucuacuguuaugagc" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cucuacuguuaugagc" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1739 " record
Length: 16
GC Content:44 %
Starting position: 625
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 16
GC Content:44 %
Starting position: 625
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "cucuacuguuaugagc" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450
siRNA sequence "cugcaaacaacuauacau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cugcaaacaacuauacau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1737 " record
Length: 18
GC Content:33 %
Starting position: 158
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 18
GC Content:33 %
Starting position: 158
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "cugcaaacaacuauacau" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450
siRNA sequence "ccaacacggcgacccua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ccaacacggcgacccua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1741 " record
Length: 17
GC Content:65 %
Starting position: 123
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 17
GC Content:65 %
Starting position: 123
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "ccaacacggcgacccua" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450
siRNA sequence "uucuaugucacgagcaa" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "uucuaugucacgagcaa" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1742 " record
Length: 17
GC Content:41 %
Starting position: 663
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 17
GC Content:41 %
Starting position: 663
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "uucuaugucacgagcaa" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450
siRNA sequence "gaaauagaugguccagc" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gaaauagaugguccagc" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1738 " record
Length: 17
GC Content:47 %
Starting position: 670
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 17
GC Content:47 %
Starting position: 670
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "gaaauagaugguccagc" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450
siRNA sequence "uuaugcauaguauauagag" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "uuaugcauaguauauagag" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1735 " record
Length: 19
GC Content:26 %
Starting position: 251
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 19
GC Content:26 %
Starting position: 251
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "uuaugcauaguauauagag" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1743 | cacgagcaauuaagcga | Human Papillomavirus [HPV] |  SL | refseqs |  | |||||
| virsi1740 | ucucuacuguuaugagcaauua | Human Papillomavirus [HPV] | SL | refseqs |  | |||||
| virsi1736 | gcaaacaacuauacaugaua | Human Papillomavirus [HPV] | SL | refseqs |  | |||||
| virsi1739 | cucuacuguuaugagc | Human Papillomavirus [HPV] | SL | refseqs |  | |||||
| virsi1737 | cugcaaacaacuauacau | Human Papillomavirus [HPV] | SL | refseqs |  | |||||
| virsi1741 | ccaacacggcgacccua | Human Papillomavirus [HPV] | SL | refseqs |  | |||||
| virsi1742 | uucuaugucacgagcaa | Human Papillomavirus [HPV] | SL | refseqs |  | |||||
| virsi1738 | gaaauagaugguccagc | Human Papillomavirus [HPV] | SL | refseqs |  | |||||
| virsi1735 | uuaugcauaguauauagag | Human Papillomavirus [HPV] | SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm