Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1036 are 1
Results from 0 - 25
siRNA sequence "aggcuguaggcauaaauuggu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aggcuguaggcauaaauuggu" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1036 " record
Length: 21
GC Content:43 %
Starting position: 1778
Transfection Reagent: siFECTamine
Incubation Time (Hours):96
Length: 21
GC Content:43 %
Starting position: 1778
Transfection Reagent: siFECTamine
Incubation Time (Hours):96
Offtargets for "aggcuguaggcauaaauuggu" siRNA in Human Genome sequences
Pubmed:19159285
Article:Controlling HBV replication in vivo by intravenous administration of triggered PEGylated siRNA-nanoparticles.
Authors:Carmona S, Jorgensen MR, Kolli S, Crowther C, Salazar FH, Marion PL, Fujino M, Natori Y, Thanou M, Arbuthnot P, Miller AD.
Journal:Mol Pharm. 2009 May-Jun;6(3):706-17.
Entrez:19159285
Article:Controlling HBV replication in vivo by intravenous administration of triggered PEGylated siRNA-nanoparticles.
Authors:Carmona S, Jorgensen MR, Kolli S, Crowther C, Salazar FH, Marion PL, Fujino M, Natori Y, Thanou M, Arbuthnot P, Miller AD.
Journal:Mol Pharm. 2009 May-Jun;6(3):706-17.
Entrez:19159285
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi1036 | aggcuguaggcauaaauuggu | Hepatitis B Virus [HBV] | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm