Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1146 are 1
Results from 0 - 25
siRNA sequence "aaggucuuacauaagaggacu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aaggucuuacauaagaggacu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1146 " record
Length: 21
GC Content:38 %
Starting position: 1646
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48
Length: 21
GC Content:38 %
Starting position: 1646
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48
Offtargets for "aaggucuuacauaagaggacu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:17334648
Article:Effective inhibition of hepatitis B virus replication by small interfering RNAs expressed from human foamy virus vectors.
Authors:Sun Y, Li Z, Li L, Li J, Liu X, Li W.
Journal:Int J Mol Med. 2007 Apr;19(4):705-11.
Entrez:17334648
Article:Effective inhibition of hepatitis B virus replication by small interfering RNAs expressed from human foamy virus vectors.
Authors:Sun Y, Li Z, Li L, Li J, Liu X, Li W.
Journal:Int J Mol Med. 2007 Apr;19(4):705-11.
Entrez:17334648
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1146 | aaggucuuacauaagaggacu | Hepatitis B Virus [HBV] |  SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm