Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1155 are 1
Results from 0 - 25
siRNA sequence "cucaguuuacuagugccauuuguuc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "cucaguuuacuagugccauuuguuc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Offtargets for "cucaguuuacuagugccauuuguuc" siRNA in Human Genome sequences
Pubmed:17049658
Article:Stable inhibition of hepatitis B virus expression and replication in HepG2.2.15 cells by RNA interference based on retrovirus delivery.
Authors:Jia F, Zhang YZ, Liu CM.
Journal:J Biotechnol. 2007 Jan 30;128(1):32-40. Epub 2006 Sep 23.
Entrez:17049658
Article:Stable inhibition of hepatitis B virus expression and replication in HepG2.2.15 cells by RNA interference based on retrovirus delivery.
Authors:Jia F, Zhang YZ, Liu CM.
Journal:J Biotechnol. 2007 Jan 30;128(1):32-40. Epub 2006 Sep 23.
Entrez:17049658
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1155 | cucaguuuacuagugccauuuguuc | Hepatitis B Virus [HBV] |  SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm