Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1165 are 1
Results from 0 - 25
siRNA sequence "gucucguagaccgugcauca" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "gucucguagaccgugcauca" Hepatitis C Virus [HCV]" Virus reference Genome sequences

Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1165 " record
Length: 20
GC Content:55 %
Starting position: 325
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 20
GC Content:55 %
Starting position: 325
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "gucucguagaccgugcauca" siRNA in Human Genome sequences
See AY045702 at Genbank
Pubmed:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi1165 | gucucguagaccgugcauca | Hepatitis C Virus [HCV] | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm