Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1221 are 1
Results from 0 - 25
siRNA sequence "gacacugagacaccaauugac" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "gacacugagacaccaauugac" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1221 " record
Length: 21
GC Content:48 %
Strain of Virus: Genotype 1b
Incubation Time (Hours):48
Length: 21
GC Content:48 %
Strain of Virus: Genotype 1b
Incubation Time (Hours):48
Offtargets for "gacacugagacaccaauugac" siRNA in Human Genome sequences
Pubmed:17305886
Article:Positional effects and strand preference of RNA interference against hepatitis C virus target sequences.
Authors:Smith RM, Smolic R, Volarevic M, Wu GY.
Journal:J Viral Hepat. 2007 Mar;14(3):194-212.
Entrez:17305886
Article:Positional effects and strand preference of RNA interference against hepatitis C virus target sequences.
Authors:Smith RM, Smolic R, Volarevic M, Wu GY.
Journal:J Viral Hepat. 2007 Mar;14(3):194-212.
Entrez:17305886
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1221 | gacacugagacaccaauugac | Hepatitis C Virus [HCV] |  SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm