Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1374 are 1
Results from 0 - 25
siRNA sequence "ucaaggaacaacauugccaaa" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "ucaaggaacaacauugccaaa" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1374 " record
Length: 21
GC Content:38 %
Starting position: 28608
GenBank Acc: NC_004741
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:38 %
Starting position: 28608
GenBank Acc: NC_004741
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "ucaaggaacaacauugccaaa" siRNA in Human Genome sequences
See NC_004741 at Genbank
Pubmed:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1374 | ucaaggaacaacauugccaaa | SARS Coronavirus |  SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm