Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1384 are 1
Results from 0 - 25
siRNA sequence "gauaauggaccccaaucaaac" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "gauaauggaccccaaucaaac" SARS Coronavirus" Virus reference Genome sequences

Browse all the records for "SARS Coronavirus" virus
Browse "virsi1384 " record
Length: 21
GC Content:43 %
Starting position: 28126
GenBank Acc: NC_004733
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:43 %
Starting position: 28126
GenBank Acc: NC_004733
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "gauaauggaccccaaucaaac" siRNA in Human Genome sequences
See NC_004733 at Genbank
Pubmed:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi1384 | gauaauggaccccaaucaaac | SARS Coronavirus | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm