Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1409 are 1
Results from 0 - 25
siRNA sequence "aacgcucgucaauauagaucu" alignment with "Vaccinia" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Vaccinia" virus
Browse "virsi1409 " record
Length: 21
GC Content:38 %
GenBank Acc: NC_001611
Transfection Reagent: siPORT
Incubation Time (Hours):48
Length: 21
GC Content:38 %
GenBank Acc: NC_001611
Transfection Reagent: siPORT
Incubation Time (Hours):48
Offtargets for "aacgcucgucaauauagaucu" siRNA in Human Genome sequences
See NC_001611 at Genbank
Pubmed:16480752
Article:siRNA targeting vaccinia virus double-stranded RNA binding protein [E3L] exerts potent antiviral effects.
Authors:Dave RS, McGettigan JP, Qureshi T, Schnell MJ, Nunnari G, Pomerantz RJ.
Journal:Virology. 2006 May 10;348(2):489-97. Epub 2006 Feb 9.
Entrez:16480752
Article:siRNA targeting vaccinia virus double-stranded RNA binding protein [E3L] exerts potent antiviral effects.
Authors:Dave RS, McGettigan JP, Qureshi T, Schnell MJ, Nunnari G, Pomerantz RJ.
Journal:Virology. 2006 May 10;348(2):489-97. Epub 2006 Feb 9.
Entrez:16480752
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1409 | aacgcucgucaauauagaucu | Vaccinia |  SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm