Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1410 are 1
Results from 0 - 25
siRNA sequence "aauacucucccgucgaugucu" alignment with "Vaccinia" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Vaccinia" virus
Browse "virsi1410 " record
Length: 21
GC Content:48 %
GenBank Acc: NC_001611
Transfection Reagent: siPORT
Incubation Time (Hours):48
Length: 21
GC Content:48 %
GenBank Acc: NC_001611
Transfection Reagent: siPORT
Incubation Time (Hours):48
Offtargets for "aauacucucccgucgaugucu" siRNA in Human Genome sequences
See NC_001611 at Genbank
Pubmed:16480752
Article:siRNA targeting vaccinia virus double-stranded RNA binding protein [E3L] exerts potent antiviral effects.
Authors:Dave RS, McGettigan JP, Qureshi T, Schnell MJ, Nunnari G, Pomerantz RJ.
Journal:Virology. 2006 May 10;348(2):489-97. Epub 2006 Feb 9.
Entrez:16480752
Article:siRNA targeting vaccinia virus double-stranded RNA binding protein [E3L] exerts potent antiviral effects.
Authors:Dave RS, McGettigan JP, Qureshi T, Schnell MJ, Nunnari G, Pomerantz RJ.
Journal:Virology. 2006 May 10;348(2):489-97. Epub 2006 Feb 9.
Entrez:16480752
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi1410 | aauacucucccgucgaugucu | Vaccinia | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm