Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1449 are 1
Results from 0 - 25
siRNA sequence "cagguccccuagaagaagaac" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "cagguccccuagaagaagaac" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1449 " record
Length: 21
GC Content:52 %
Transfection Reagent: Lipofectamine
Incubation Time (Hours):96
Length: 21
GC Content:52 %
Transfection Reagent: Lipofectamine
Incubation Time (Hours):96
Offtargets for "cagguccccuagaagaagaac" siRNA in Human Genome sequences
Pubmed:18609708
Article:Combination of small interfering RNAs mediates greater suppression on hepatitis B virus cccDNA in HepG2.2.15 cells.
Authors:Xin XM, Li GQ, Jin YY, Zhuang M, Li D.
Journal:World J Gastroenterol. 2008 Jun 28;14(24):3849-54.
Entrez:18609708
Article:Combination of small interfering RNAs mediates greater suppression on hepatitis B virus cccDNA in HepG2.2.15 cells.
Authors:Xin XM, Li GQ, Jin YY, Zhuang M, Li D.
Journal:World J Gastroenterol. 2008 Jun 28;14(24):3849-54.
Entrez:18609708
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi1449 | cagguccccuagaagaagaac | Hepatitis B Virus [HBV] | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm