Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1477 are 1
Results from 0 - 25
siRNA sequence "gauuccuaggaccccuucucg" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gauuccuaggaccccuucucg" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1477 " record
Length: 21
GC Content:57 %
Starting position: 176
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):96
Length: 21
GC Content:57 %
Starting position: 176
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):96
Offtargets for "gauuccuaggaccccuucucg" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:15850463
Article:Inhibition of hepatitis B virus replication in 2.2.15 cells by expressed shRNA.
Authors:Ren XR, Zhou LJ, Luo GB, Lin B, Xu A.
Journal:J Viral Hepat. 2005 May;12(3):236-42.
Entrez:15850463
Article:Inhibition of hepatitis B virus replication in 2.2.15 cells by expressed shRNA.
Authors:Ren XR, Zhou LJ, Luo GB, Lin B, Xu A.
Journal:J Viral Hepat. 2005 May;12(3):236-42.
Entrez:15850463
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi1477 | gauuccuaggaccccuucucg | Hepatitis B Virus [HBV] | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm