Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1667 are 1
Results from 0 - 25
siRNA sequence "agcucaaacuuucgaaaucaa" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "agcucaaacuuucgaaaucaa" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1667 " record
Length: 21
GC Content:33 %
Starting position: 3279
GenBank Acc: M19183
Transfection Reagent: Lipofectamine 2000
Length: 21
GC Content:33 %
Starting position: 3279
GenBank Acc: M19183
Transfection Reagent: Lipofectamine 2000
Offtargets for "agcucaaacuuucgaaaucaa" siRNA in Human Genome sequences
See M19183 at Genbank
Pubmed:19064272
Article:Inhibition of woodchuck hepatitis virus gene expression in primary hepatocytes by siRNA enhances the cellular gene expression.
Authors:Meng Z, Qiu S, Zhang X, Wu J, Schreiter T, Xu Y, Yang D, Roggendorf M, Schlaak J, Lu M.
Journal:Virology. 2009 Feb 5;384(1):88-96. Epub 2008 Dec 6.
Entrez:19064272
Article:Inhibition of woodchuck hepatitis virus gene expression in primary hepatocytes by siRNA enhances the cellular gene expression.
Authors:Meng Z, Qiu S, Zhang X, Wu J, Schreiter T, Xu Y, Yang D, Roggendorf M, Schlaak J, Lu M.
Journal:Virology. 2009 Feb 5;384(1):88-96. Epub 2008 Dec 6.
Entrez:19064272
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1667 | agcucaaacuuucgaaaucaa | Hepatitis B Virus [HBV] |  SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm