Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1707 are 1
Results from 0 - 25
siRNA sequence "aauguguguacugcaagcaac" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "aauguguguacugcaagcaac" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1707 " record
Length: 21
GC Content:43 %
Starting position: 189
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Calcium Phosohate
Incubation Time (Hours):24
Length: 21
GC Content:43 %
Starting position: 189
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Calcium Phosohate
Incubation Time (Hours):24
Offtargets for "aauguguguacugcaagcaac" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:19276448
Article:E6 and e7 gene silencing and transformed phenotype of human papillomavirus 16-positive oropharyngeal cancer cells.
Authors:Rampias T, Sasaki C, Weinberger P, Psyrri A.
Journal:J Natl Cancer Inst. 2009 Mar 18;101(6):412-23. Epub 2009 Mar 10.
Entrez:19276448
Article:E6 and e7 gene silencing and transformed phenotype of human papillomavirus 16-positive oropharyngeal cancer cells.
Authors:Rampias T, Sasaki C, Weinberger P, Psyrri A.
Journal:J Natl Cancer Inst. 2009 Mar 18;101(6):412-23. Epub 2009 Mar 10.
Entrez:19276448
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1707 | aauguguguacugcaagcaac | Human Papillomavirus [HPV] |  SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm