Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1736 are 1
Results from 0 - 25
siRNA sequence "gcaaacaacuauacaugaua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gcaaacaacuauacaugaua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1736 " record
Length: 20
GC Content:30 %
Starting position: 160
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 20
GC Content:30 %
Starting position: 160
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "gcaaacaacuauacaugaua" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1736 | gcaaacaacuauacaugaua | Human Papillomavirus [HPV] |  SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm