Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1847 are 1
Results from 0 - 25
siRNA sequence "aaggcacuucagagcccacca" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "aaggcacuucagagcccacca" Epstein-Barr Virus [EBV]" Virus reference Genome sequences
Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1847 " record
Length: 21
GC Content:57 %
Starting position: 137200
Strain of Virus: B95-8
GenBank Acc: NC_009334
Transfection Reagent: Jetsi-ENDO
Incubation Time (Hours):72
Length: 21
GC Content:57 %
Starting position: 137200
Strain of Virus: B95-8
GenBank Acc: NC_009334
Transfection Reagent: Jetsi-ENDO
Incubation Time (Hours):72
Offtargets for "aaggcacuucagagcccacca" siRNA in Human Genome sequences
See NC_009334 at Genbank
Pubmed:19704168
Article:Inhibition of Epstein-Barr virus replication by small interfering RNA targeting the Epstein-Barr virus protease gene.
Authors:Larrat S, Morand P, Bas A, Vigne S, Crance JM, Boyer V, Nicod S, Grossi L, Buisson M, Burmeister WP, Seigneurin JM, Germi R.
Journal:Antivir Ther. 2009;14(5):655-62.
Entrez:19704168
Article:Inhibition of Epstein-Barr virus replication by small interfering RNA targeting the Epstein-Barr virus protease gene.
Authors:Larrat S, Morand P, Bas A, Vigne S, Crance JM, Boyer V, Nicod S, Grossi L, Buisson M, Burmeister WP, Seigneurin JM, Germi R.
Journal:Antivir Ther. 2009;14(5):655-62.
Entrez:19704168
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1847 | aaggcacuucagagcccacca | Epstein-Barr Virus [EBV] |  SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands: siRNA Not specific SL: siRNA seedlocator algorithm