VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for virsi1938 are 1
Results from 0 - 25

siRNA sequence "aaagagggucaauccauucuu" alignment with "Hendra Virus" virus reference Genome sequences
siRNA sequence matching with "aaagagggucaauccauucuu" Hendra Virus" Virus reference Genome sequences
Browse all the records for "Hendra Virus" virus
Browse "virsi1938 " record
Length: 21
GC Content:38 %
Starting position: 712
Strain of Virus: Hev
GenBank Acc: AF017149
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24

Offtargets for "aaagagggucaauccauucuu" siRNA in Human Genome sequences
See AF017149 at Genbank
Pubmed:18687361
Article:Inhibition of Henipavirus infection by RNA interference.
Authors:Mungall BA, Schopman NC, Lambeth LS, Doran TJ.
Journal:Antiviral Res. 2008 Dec;80(3):324-31. Epub 2008 Aug 5.
Entrez:18687361


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1938	aaagagggucaauccauucuu	Hendra Virus	N	BHK-21	Cell Count	Low	18687361	Blast SL	refseqs



: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm