Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1993 are 1
Results from 0 - 25
siRNA sequence "gggcgcugugacauuaaggac" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "gggcgcugugacauuaaggac" SARS Coronavirus" Virus reference Genome sequences

Browse all the records for "SARS Coronavirus" virus
Browse "virsi1993 " record
Length: 21
GC Content:57 %
Starting position: 466
Strain of Virus: HKU-39849
GenBank Acc: AY278491
Transfection Reagent: Profectin
Incubation Time (Hours):48
Length: 21
GC Content:57 %
Starting position: 466
Strain of Virus: HKU-39849
GenBank Acc: AY278491
Transfection Reagent: Profectin
Incubation Time (Hours):48
Offtargets for "gggcgcugugacauuaaggac" siRNA in Human Genome sequences
See AY278491 at Genbank
Pubmed:20956884
Article:Small interfering RNA effectively inhibits the expression of SARS coronavirus membrane gene at two novel targeting sites.
Authors:Wang Y, Cao YL, Yang F, Zhang Y, Wang SH, Liu L.
Journal:Molecules. 2010 Oct 18;15(10):7197-207.
Entrez:20956884
Article:Small interfering RNA effectively inhibits the expression of SARS coronavirus membrane gene at two novel targeting sites.
Authors:Wang Y, Cao YL, Yang F, Zhang Y, Wang SH, Liu L.
Journal:Molecules. 2010 Oct 18;15(10):7197-207.
Entrez:20956884
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi1993 | gggcgcugugacauuaaggac | SARS Coronavirus | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm