Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi2134 are 1
Results from 0 - 25
siRNA sequence "aaggcgacaaccuauccccaa" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "aaggcgacaaccuauccccaa" Hepatitis C Virus [HCV]" Virus reference Genome sequences

Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2134 " record
Length: 21
GC Content:52 %
Starting position: 523
Strain of Virus: Isolate Con1
GenBank Acc: AJ238799
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 21
GC Content:52 %
Starting position: 523
Strain of Virus: Isolate Con1
GenBank Acc: AJ238799
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "aaggcgacaaccuauccccaa" siRNA in Human Genome sequences
See AJ238799 at Genbank
Pubmed:16979254
Article:Inhibition of hepatitis C virus gene expression by small interfering RNAs using a tri-cistronic full-length viral replicon and a transient mouse model.
Authors:Kim M, Shin D, Kim SI, Park M.
Journal:Virus Res. 2006 Dec;122(1-2):1-10. Epub 2006 Sep 15.
Entrez:16979254
Article:Inhibition of hepatitis C virus gene expression by small interfering RNAs using a tri-cistronic full-length viral replicon and a transient mouse model.
Authors:Kim M, Shin D, Kim SI, Park M.
Journal:Virus Res. 2006 Dec;122(1-2):1-10. Epub 2006 Sep 15.
Entrez:16979254
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi2134 | aaggcgacaaccuauccccaa | Hepatitis C Virus [HCV] | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm