Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi2139 are 1
Results from 0 - 25
siRNA sequence "aagccuucugggcgaagcaua" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "aagccuucugggcgaagcaua" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2139 " record
Length: 21
GC Content:52 %
Starting position: 8749
Strain of Virus: Isolate Con1
GenBank Acc: AJ238799
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 21
GC Content:52 %
Starting position: 8749
Strain of Virus: Isolate Con1
GenBank Acc: AJ238799
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "aagccuucugggcgaagcaua" siRNA in Human Genome sequences
See AJ238799 at Genbank
Pubmed:16979254
Article:Inhibition of hepatitis C virus gene expression by small interfering RNAs using a tri-cistronic full-length viral replicon and a transient mouse model.
Authors:Kim M, Shin D, Kim SI, Park M.
Journal:Virus Res. 2006 Dec;122(1-2):1-10. Epub 2006 Sep 15.
Entrez:16979254
Article:Inhibition of hepatitis C virus gene expression by small interfering RNAs using a tri-cistronic full-length viral replicon and a transient mouse model.
Authors:Kim M, Shin D, Kim SI, Park M.
Journal:Virus Res. 2006 Dec;122(1-2):1-10. Epub 2006 Sep 15.
Entrez:16979254
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi2139 | aagccuucugggcgaagcaua | Hepatitis C Virus [HCV] |  SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm