Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi2180 are 1
Results from 0 - 25
siRNA sequence "ccaugagcacgaauccuaaa" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ccaugagcacgaauccuaaa" Hepatitis C Virus [HCV]" Virus reference Genome sequences

Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2180 " record
Length: 20
GC Content:45 %
GenBank Acc: NC_004102
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 20
GC Content:45 %
GenBank Acc: NC_004102
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "ccaugagcacgaauccuaaa" siRNA in Human Genome sequences
See NC_004102 at Genbank
Pubmed:16566896
Article:Inhibition of hepatitis C virus RNA replication by short hairpin RNA synthesized by T7 RNA polymerase in hepatitis C virus subgenomic replicons.
Authors:Hamazaki H, Ujino S, Miyano-Kurosaki N, Shimotohno K, Takaku H.
Journal:Biochem Biophys Res Commun. 2006 May 12;343(3):988-94. Epub 2006 Mar 29.
Entrez:16566896
Article:Inhibition of hepatitis C virus RNA replication by short hairpin RNA synthesized by T7 RNA polymerase in hepatitis C virus subgenomic replicons.
Authors:Hamazaki H, Ujino S, Miyano-Kurosaki N, Shimotohno K, Takaku H.
Journal:Biochem Biophys Res Commun. 2006 May 12;343(3):988-94. Epub 2006 Mar 29.
Entrez:16566896
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi2180 | ccaugagcacgaauccuaaa | Hepatitis C Virus [HCV] | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm