Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi2277 are 1
Results from 0 - 25
siRNA sequence "ggcgcagcuucgacgucauau" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ggcgcagcuucgacgucauau" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2277 " record
Length: 21
GC Content:57 %
Strain of Virus: 1a
GenBank Acc: M62321
Incubation Time (Hours):48
Length: 21
GC Content:57 %
Strain of Virus: 1a
GenBank Acc: M62321
Incubation Time (Hours):48
Offtargets for "ggcgcagcuucgacgucauau" siRNA in Human Genome sequences
See M62321 at Genbank
Pubmed:21535893
Article:Inhibition of full length hepatitis C virus particles of 1a genotype through small interference RNA.
Authors:Ansar M, Ashfaq UA, Shahid I, Sarwar MT, Javed T, Rehman S, Hassan S, Riazuddin S.
Journal:Virol J. 2011 May 2;8:203.
Entrez:21535893
Article:Inhibition of full length hepatitis C virus particles of 1a genotype through small interference RNA.
Authors:Ansar M, Ashfaq UA, Shahid I, Sarwar MT, Javed T, Rehman S, Hassan S, Riazuddin S.
Journal:Virol J. 2011 May 2;8:203.
Entrez:21535893
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi2277 | ggcgcagcuucgacgucauau | Hepatitis C Virus [HCV] |  SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands: siRNA Not specific SL: siRNA seedlocator algorithm