Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi3001 are 1
Results from 0 - 25
siRNA sequence "gacacugagacaccaauugac" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi3001 " record
Length: 21
GC Content:48 %
Starting position: 7982
GenBank Acc: HQ908359
Transfection Reagent: Electroporation
Length: 21
GC Content:48 %
Starting position: 7982
GenBank Acc: HQ908359
Transfection Reagent: Electroporation
Offtargets for "gacacugagacaccaauugac" siRNA in Human Genome sequences
See HQ908359 at Genbank
Pubmed:15890944
Article:Hepatitis C virus replicons escape RNA interference induced by a short interfering RNA directed against the NS5b coding region.
Authors:Wilson JA, Richardson CD.
Journal:J Virol. 2005 Jun;79(11):7050-8.
Entrez:15890944
Article:Hepatitis C virus replicons escape RNA interference induced by a short interfering RNA directed against the NS5b coding region.
Authors:Wilson JA, Richardson CD.
Journal:J Virol. 2005 Jun;79(11):7050-8.
Entrez:15890944
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi3001 | gacacugagacaccaauugac | Hepatitis C Virus [HCV] | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm