VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for 16900331 are 2
Results from 0 - 25

siRNA sequence "cucaguuuacuagugccauuuguuc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "cucaguuuacuagugccauuuguuc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1153 " record
Length: 25
GC Content:40 %
Starting position: 516

Offtargets for "cucaguuuacuagugccauuuguuc" siRNA in Human Genome sequences
See at Genbank
Pubmed:16900331
Article:A retrovirus-based system to stably silence hepatitis B virus genes by RNA interference.
Authors:Jia F, Zhang YZ, Liu CM.
Journal:Biotechnol Lett. 2006 Oct;28(20):1679-85. Epub 2006 Aug 10.
Entrez:16900331

siRNA sequence "caucacaucaggauuccua" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "caucacaucaggauuccua" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1152 " record
Length: 19
GC Content:42 %
Starting position: 9

Offtargets for "caucacaucaggauuccua" siRNA in Human Genome sequences
See at Genbank
Pubmed:16900331
Article:A retrovirus-based system to stably silence hepatitis B virus genes by RNA interference.
Authors:Jia F, Zhang YZ, Liu CM.
Journal:Biotechnol Lett. 2006 Oct;28(20):1679-85. Epub 2006 Aug 10.
Entrez:16900331


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1153	cucaguuuacuagugccauuuguuc	Hepatitis B Virus [HBV]	P/S	HepG2.2.15	Protein	97	16900331	Blast SL	refseqs
virsi1152	caucacaucaggauuccua	Hepatitis B Virus [HBV]	P/S	HepG2.2.15	Protein	95	16900331	Blast SL	refseqs



: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm