virsi1397 sIRNA sequence "agcaguacgcacacaaucgaa" was aligned with "SARS Coronavirus" reference genome sequences using ALIGN0 Algorithm results are displayed as pie chart. This chart shows the alignment statistics with number of genomes having 0 MM (Mismatch) i,e 100% matching with siRNA agcaguacgcacacaaucgaa sequence and number of genome having 1,2,3 or >3 mismatche with with siRNA