| siRNA Id: | virsi1018 |
| Sense Sequence: | aacacuuccggaaacuacugu |
| Length: | 21 |
| GC Content (%): | 43 |
| Virus Name: | Hepatitis B Virus [HBV] |
| Family of Virus: | Hepadnaviridae |
| Target Gene: | P |
| Cell Line: | HepG2.2.15 |
| Transfection Method: | Lipofectamine 2000 |
| Incubation Time (Hours): | 96 |
| PubMed: | 17300745 |
| Target Object (mRNA,Protein,etc): | RNA |
| Silencing Efficacy : | 40 |
| Structure: | ![]() |
| siRNA sequence matching with Hepatitis B Virus [HBV] reference genome: | ![]() |
| RNA % inhibition: | 40 |
| RNA Detection method: | RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.

