| siRNA Id: | virsi1021 |
| Sense Sequence: | aaccuccaaucacucaccaac |
| Length: | 21 |
| GC Content (%): | 48 |
| Virus Name: | Hepatitis B Virus [HBV] |
| Family of Virus: | Hepadnaviridae |
| Virus Strain: | ayw |
| Target Gene: | S |
| Genbank Accession: | U95551 |
| Starting Position | 322 |
| Ending Position: | 342 |
| Cell Line: | HepG2.2.15 |
| Transfection Method: | Lipofectamine 2000 |
| Incubation Time (Hours): | 72 |
| siRNA Expression Method: | Expressed |
| siRNA design algorithm used: | Ambion |
| PubMed: | 18274934 |
| Target Object (mRNA,Protein,etc): | mRNA |
| Silencing Efficacy : | 59 |
| siRNA sequence matching with Hepatitis B Virus [HBV] reference genome: |  |
| Target mRNA1: | HBsAg |
| mRNA1 % inhibition: | 58.79 |
| mRNA1 Detection Method: | RT-PCR |
| Protein2: | HBsAg |
| Protein2 % inhibition : | 55.03 |
| Protein2 Detection Method: | ELISA |
.
.
.
.
.
.
.
.
.
.
.
.
.