siRNA Id: | virsi1029 |
Sense Sequence: | aauguugcccaaggucuuaca |
Length: | 21 |
GC Content (%): | 43 |
Virus Name: | Hepatitis B Virus [HBV] |
Family of Virus: | Hepadnaviridae |
Virus Strain: | ayw |
Target Gene: | P |
Genbank Accession: | U95551 |
Starting Position | 261 |
Ending Position: | 281 |
Cell Line: | HepG2.2.15 |
Transfection Method: | siPORT |
Incubation Time (Hours): | 72 |
siRNA Expression Method: | Expressed |
siRNA design algorithm used: | Ambion |
PubMed: | 16111658 |
Target Object (mRNA,Protein,etc): | Protein |
Silencing Efficacy : | 65 |
Structure: | |
siRNA sequence matching with Hepatitis B Virus [HBV] reference genome: | |
Protein1: | HBeAg |
Protein1 % inhibition: | 65 |
Protein1 Detection Method: | ELISA |
Protein2: | HBeAg |
Protein2 % inhibition : | 75 |
.
.
.
.
.
.
.
.
.
.
.
.
.