virsi1034 details

siRNA Id:virsi1034
Sense Sequence: ugggggaggagauuagguuaa
Length: 21
GC Content (%):48
Virus Name:Hepatitis B Virus [HBV]
Family of Virus:Hepadnaviridae
Target Gene:HBeAg
Starting Position 1741
Ending Position: 1763
Cell Line: Huh-7
Transfection Method: siFECTamine
Incubation Time (Hours): 96
siRNA Expression Method: Chemically Synthesized
PubMed:19159285
Target Object (mRNA,Protein,etc): Protein
Silencing Efficacy :Low
Structure:
siRNA sequence matching with Hepatitis B Virus [HBV] reference genome:
mRNA1 % inhibition:Low
mRNA1 Detection Method:ECLIA

.
.
.
.
.
.
.
.
.
.
.

.

.

.