siRNA Id: | virsi1037 |
Sense Sequence: | uuggucugcgcaccaucauca |
Length: | 21 |
GC Content (%): | 52 |
Virus Name: | Hepatitis B Virus [HBV] |
Family of Virus: | Hepadnaviridae |
Target Gene: | HBeAg |
Starting Position | 1794 |
Ending Position: | 1816 |
Cell Line: | Huh-7 |
Transfection Method: | siFECTamine |
Incubation Time (Hours): | 96 |
siRNA Expression Method: | Chemically Synthesized |
PubMed: | 19159285 |
Target Object (mRNA,Protein,etc): | Protein |
Silencing Efficacy : | 60 |
Structure: | ![]() |
siRNA sequence matching with Hepatitis B Virus [HBV] reference genome: | ![]() |
mRNA1 % inhibition: | 60 |
mRNA1 Detection Method: | ECLIA |
Protein2: | HBsAg |
Protein2 % inhibition : | 60 |
Protein2 Detection Method: | HBsAg Level |
.
.
.
.
.
.
.
.
.
.
.
.
.