| siRNA Id: | virsi1038 |
| Sense Sequence: | uggucugcgcaccaucaucau |
| Length: | 21 |
| GC Content (%): | 52 |
| Virus Name: | Hepatitis B Virus [HBV] |
| Family of Virus: | Hepadnaviridae |
| Target Gene: | HBeAg |
| Starting Position | 1795 |
| Ending Position: | 1817 |
| Cell Line: | Huh-7 |
| Transfection Method: | siFECTamine |
| Incubation Time (Hours): | 96 |
| siRNA Expression Method: | Chemically Synthesized |
| PubMed: | 19159285 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | Low |
| Structure: |  |
| siRNA sequence matching with Hepatitis B Virus [HBV] reference genome: |  |
| mRNA1 % inhibition: | Low |
| mRNA1 Detection Method: | ECLIA |
.
.
.
.
.
.
.
.
.
.
.
.
.