siRNA Id: | virsi1080 |
Sense Sequence: | ggcugcuaugccucaucuucu |
Length: | 21 |
GC Content (%): | 52 |
Virus Name: | Hepatitis B Virus [HBV] |
Family of Virus: | Hepadnaviridae |
Target Gene: | S |
Cell Line: | HepG2.2.15 |
Transfection Method: | Effectene |
Incubation Time (Hours): | 120 |
siRNA Expression Method: | Chemically Synthesized |
PubMed: | 16254373 |
Target Object (mRNA,Protein,etc): | Protein |
Silencing Efficacy : | 67 |
Structure: | |
siRNA sequence matching with Hepatitis B Virus [HBV] reference genome: | |
Virus Load % inhibition: | 87.09 |
Virus Load Method: | Real-Time PCR |
mRNA1 % inhibition: | 60.94 |
mRNA1 Detection Method: | Real-Time PCR |
Protein1: | HBsAg |
Protein1 % inhibition: | 66.66 |
Protein1 Detection Method: | ELISA |
.
.
.
.
.
.
.
.
.
.
.
.
.