| siRNA Id: | virsi1081 |
| Sense Sequence: | ggcuccucugccgauccauac |
| Length: | 21 |
| GC Content (%): | 62 |
| Virus Name: | Hepatitis B Virus [HBV] |
| Family of Virus: | Hepadnaviridae |
| Target Gene: | S |
| Cell Line: | HepG2.2.15 |
| Transfection Method: | Effectene |
| Incubation Time (Hours): | 120 |
| siRNA Expression Method: | Chemically Synthesized |
| PubMed: | 16254373 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | 88 |
| Structure: |  |
| siRNA sequence matching with Hepatitis B Virus [HBV] reference genome: |  |
| Virus Load % inhibition: | 90.42 |
| Virus Load Method: | Real-Time PCR |
| mRNA1 % inhibition: | 86.12 |
| mRNA1 Detection Method: | Real-Time PCR |
| Protein1: | HBsAg |
| Protein1 % inhibition: | 88.18 |
| Protein1 Detection Method: | ELISA |
.
.
.
.
.
.
.
.
.
.
.
.
.