| siRNA Id: | virsi1086 |
| Sense Sequence: | ggccaaguguuugcugacgca |
| Length: | 21 |
| GC Content (%): | 57 |
| Virus Name: | Hepatitis B Virus [HBV] |
| Family of Virus: | Hepadnaviridae |
| Target Gene: | S |
| Cell Line: | HepG2.2.15 |
| Transfection Method: | Effectene |
| Incubation Time (Hours): | 120 |
| siRNA Expression Method: | Chemically Synthesized |
| PubMed: | 16254373 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | 15 |
| Structure: | ![]() |
| siRNA sequence matching with Hepatitis B Virus [HBV] reference genome: | ![]() |
| Protein1: | HBsAg |
| Protein1 % inhibition: | 15 |
| Protein1 Detection Method: | ELISA |
.
.
.
.
.
.
.
.
.
.
.
.
.

