siRNA Id: | virsi1107 |
Sense Sequence: | ggacgcaccuugggagaggu |
Length: | 20 |
GC Content (%): | 65 |
Virus Name: | West Nile Virus [WNV] |
Family of Virus: | Flaviviridae |
Virus Strain: | Linage |
Target Gene: | NS5 |
Genbank Accession: | DQ211652 |
Starting Position | 7693 |
Ending Position: | 7712 |
Cell Line: | Huh-7 .5 |
Transfection Method: | Lipid-Based Reagent/Electroporation |
Incubation Time (Hours): | 48 |
siRNA design algorithm used: | SciTools |
PubMed: | 15985182 |
Target Object (mRNA,Protein,etc): | Protein |
Silencing Efficacy : | Low |
Structure: | ![]() |
siRNA sequence matching with West Nile Virus [WNV] reference genome: | ![]() |
Protein1 % inhibition: | Low |
Protein1 Detection Method: | Flow Cytometry |
.
.
.
.
.
.
.
.
.
.
.
.
.