| siRNA Id: | virsi1112 |
| Sense Sequence: | gagagauaugaagacacaac |
| Length: | 20 |
| GC Content (%): | 40 |
| Virus Name: | West Nile Virus [WNV] |
| Family of Virus: | Flaviviridae |
| Virus Strain: | Linage |
| Target Gene: | NS5 |
| Genbank Accession: | DQ211652 |
| Starting Position | 10335 |
| Ending Position: | 10354 |
| Cell Line: | Huh-7 .5 |
| Transfection Method: | Lipid-Based Reagent/Electroporation |
| Incubation Time (Hours): | 48 |
| siRNA design algorithm used: | SciTools |
| PubMed: | 15985182 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | Low |
| Structure: | ![]() |
| siRNA sequence matching with West Nile Virus [WNV] reference genome: | ![]() |
| Protein1 % inhibition: | Low |
| Protein1 Detection Method: | Flow Cytometry |
.
.
.
.
.
.
.
.
.
.
.
.
.

