| siRNA Id: | virsi1114 |
| Sense Sequence: | aauaccgcagagucuagacuc |
| Length: | 21 |
| GC Content (%): | 48 |
| Virus Name: | Hepatitis B Virus [HBV] |
| Family of Virus: | Hepadnaviridae |
| Virus Strain: | ayw |
| Target Gene: | P/S |
| Genbank Accession: | U95551 |
| Starting Position | 237 |
| Ending Position: | 257 |
| Cell Line: | HepG2.2.15 |
| Transfection Method: | Lipofectamine 2000 |
| Incubation Time (Hours): | 48 |
| siRNA design algorithm used: | Ambion |
| PubMed: | 19026173 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | 72 |
| Structure: |  |
| siRNA sequence matching with Hepatitis B Virus [HBV] reference genome: |  |
| Target mRNA1: | S/P mRNA |
| mRNA1 % inhibition: | 66 |
| mRNA1 Detection Method: | Real Time RT-PCR |
| Target mRNA2: | C/P mRNA |
| Protein1: | HBeAg |
| Protein1 % inhibition: | 38 |
| Protein1 Detection Method: | ELISA |
| Protein2: | HBsAg |
| Protein2 % inhibition : | 72 |
| Protein2 Detection Method: | ELISA |
.
.
.
.
.
.
.
.
.
.
.
.
.