virsi1118 details

siRNA Id:virsi1118
Sense Sequence: auguugcccguuuguccucua
Length: 21
GC Content (%):48
Virus Name:Hepatitis B Virus [HBV]
Family of Virus:Hepadnaviridae
Virus Strain:ayw
Target Gene:P/S
Genbank Accession: U95551
Starting Position 463
Ending Position: 483
Cell Line: HepG2.2.15
Transfection Method: Lipofectamine 2000
Incubation Time (Hours): 48
siRNA design algorithm used: Ambion
PubMed:19026173
Target Object (mRNA,Protein,etc): Protein
Silencing Efficacy :54
Structure:
siRNA sequence matching with Hepatitis B Virus [HBV] reference genome:
Virus Load % inhibition:26
Virus Load Method:Real-Time PCR
Target mRNA1:S/P mRNA
mRNA1 % inhibition:66
mRNA1 Detection Method:Real Time RT-PCR
Target mRNA2:C/P mRNA
mRNA2 % inhibition :48
mRNA2 Detection Method:Real Time RT-PCR
Protein1:HBeAg
Protein1 % inhibition:62
Protein1 Detection Method:ELISA
Protein2:HBsAg
Protein2 % inhibition :54
Protein2 Detection Method:ELISA

.
.
.
.
.
.
.
.
.
.
.

.

.

.