| siRNA Id: | virsi1137 |
| Sense Sequence: | gccuccaagcugugccuuggg |
| Length: | 21 |
| GC Content (%): | 67 |
| Virus Name: | Hepatitis B Virus [HBV] |
| Family of Virus: | Hepadnaviridae |
| Virus Strain: | adr |
| Target Gene: | C |
| Genbank Accession: | AF286594 |
| Starting Position | 1868 |
| Ending Position: | 1886 |
| Cell Line: | Huh-7 |
| Transfection Method: | FuGENE |
| Incubation Time (Hours): | 72 |
| siRNA Expression Method: | Liposome |
| siRNA design algorithm used: | Ambion |
| PubMed: | 15378775 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | 63 |
| Structure: |  |
| siRNA sequence matching with Hepatitis B Virus [HBV] reference genome: |  |
| Virus Load % inhibition: | 97 |
| Virus Load Method: | Northern Blot |
| Protein1: | HBeAg |
| Protein1 % inhibition: | 56.7 |
| Protein1 Detection Method: | ELISA |
| Protein2: | HBsAg |
| Protein2 % inhibition : | 62.5 |
| Protein2 Detection Method: | ELISA |
.
.
.
.
.
.
.
.
.
.
.
.
.