| siRNA Id: | virsi1140 |
| Sense Sequence: | aagauccagcaucuagagacc |
| Length: | 21 |
| GC Content (%): | 48 |
| Virus Name: | Hepatitis B Virus [HBV] |
| Family of Virus: | Hepadnaviridae |
| Virus Strain: | ayw |
| Target Gene: | C |
| Genbank Accession: | U95551 |
| Starting Position | 2235 |
| Cell Line: | HepG2 |
| Transfection Method: | Lipofectamine |
| Incubation Time (Hours): | 48 |
| siRNA Expression Method: | Expressed |
| siRNA design algorithm used: | Ambion |
| PubMed: | 17334648 |
| Target Object (mRNA,Protein,etc): | RNA |
| Silencing Efficacy : | 46 |
| Structure: |  |
| siRNA sequence matching with Hepatitis B Virus [HBV] reference genome: |  |
| Virus Load % inhibition: | 45.5 |
| Virus Load Method: | Real-Time PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.