siRNA Id: | virsi1141 |
Sense Sequence: | aaguucaggcaacucuugugg |
Length: | 21 |
GC Content (%): | 48 |
Virus Name: | Hepatitis B Virus [HBV] |
Family of Virus: | Hepadnaviridae |
Virus Strain: | ayw |
Target Gene: | C |
Genbank Accession: | U95551 |
Starting Position | 2188 |
Cell Line: | HepG2 |
Transfection Method: | Lipofectamine |
Incubation Time (Hours): | 48 |
siRNA Expression Method: | Expressed |
siRNA design algorithm used: | Ambion |
PubMed: | 17334648 |
Target Object (mRNA,Protein,etc): | RNA |
Silencing Efficacy : | 79 |
Structure: | ![]() |
siRNA sequence matching with Hepatitis B Virus [HBV] reference genome: | ![]() |
Virus Load % inhibition: | 78.8 |
Virus Load Method: | Real-Time PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.