virsi1162 details

siRNA Id:virsi1162
Sense Sequence: gccauaguggucugcggaacc
Length: 21
GC Content (%):62
Virus Name:Hepatitis C Virus [HCV]
Family of Virus:Flaviviridae
Virus Strain:Isolate HCR6
Target Gene:5'UTR
Genbank Accession: AY045702
Starting Position 139
Ending Position: 159
Cell Line: Huh-7
Transfection Method: Lipofectamine 2000
Incubation Time (Hours): 24
siRNA Expression Method: Chemically Synthesized
siRNA design algorithm used: Ambion
PubMed:16496015
Target Object (mRNA,Protein,etc): Protein
Silencing Efficacy :5
Structure:
siRNA sequence matching with Hepatitis C Virus [HCV] reference genome:
RNA % inhibition:4.8
RNA Detection method:Luciferase Assay

.
.
.
.
.
.
.
.
.
.
.

.

.

.