siRNA Id: | virsi1166 |
Sense Sequence: | agaaaaaccaaacguaacac |
Length: | 20 |
GC Content (%): | 35 |
Virus Name: | Hepatitis C Virus [HCV] |
Family of Virus: | Flaviviridae |
Virus Strain: | Isolate HCR6 |
Target Gene: | 5'UTR |
Genbank Accession: | AY045702 |
Starting Position | 368 |
Ending Position: | 387 |
Cell Line: | Huh-7 |
Transfection Method: | Lipofectamine 2000 |
Incubation Time (Hours): | 24 |
siRNA Expression Method: | Chemically Synthesized |
siRNA design algorithm used: | Ambion |
PubMed: | 16496015 |
Target Object (mRNA,Protein,etc): | Protein |
Silencing Efficacy : | 55 |
Structure: | ![]() |
siRNA sequence matching with Hepatitis C Virus [HCV] reference genome: | ![]() |
RNA % inhibition: | 55.4 |
RNA Detection method: | Luciferase Assay |
.
.
.
.
.
.
.
.
.
.
.
.
.