| siRNA Id: | virsi1167 |
| Sense Sequence: | ggcuccaucuuagcccuaguc |
| Length: | 21 |
| GC Content (%): | 57 |
| Virus Name: | Hepatitis C Virus [HCV] |
| Family of Virus: | Flaviviridae |
| Virus Strain: | Isolate HCR6 |
| Target Gene: | 3'UTR |
| Genbank Accession: | AY045702 |
| Starting Position | 9517 |
| Ending Position: | 9537 |
| Cell Line: | Huh-7 |
| Transfection Method: | Lipofectamine 2000 |
| Incubation Time (Hours): | 24 |
| siRNA Expression Method: | Chemically Synthesized |
| siRNA design algorithm used: | Ambion |
| PubMed: | 16496015 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | 31 |
| Structure: |  |
| siRNA sequence matching with Hepatitis C Virus [HCV] reference genome: |  |
| RNA % inhibition: | 30.6 |
| RNA Detection method: | Luciferase Assay |
.
.
.
.
.
.
.
.
.
.
.
.
.