virsi1173 details

siRNA Id:virsi1173
Sense Sequence: ccgggaggucucguagaccgugcauca
Length: 27
GC Content (%):63
Virus Name:Hepatitis C Virus [HCV]
Family of Virus:Flaviviridae
Virus Strain:Isolate HCR6
Target Gene:5'UTR
Genbank Accession: AY045702
Starting Position 318
Ending Position: 344
Cell Line: Huh-7
Transfection Method: Lipofectamine 2000
Incubation Time (Hours): 48
siRNA Expression Method: Chemically Synthesized
siRNA design algorithm used: Ambion
PubMed:16496015
Target Object (mRNA,Protein,etc): Protein
Silencing Efficacy :89
Structure:
siRNA sequence matching with Hepatitis C Virus [HCV] reference genome:
RNA % inhibition:89
RNA Detection method:Luciferase Assay

.
.
.
.
.
.
.
.
.
.
.

.

.

.