| siRNA Id: | virsi1183 |
| Sense Sequence: | gacacugagacaccaauugac |
| Length: | 21 |
| GC Content (%): | 48 |
| Virus Name: | Hepatitis C Virus [HCV] |
| Family of Virus: | Flaviviridae |
| Target Gene: | NS5B |
| Starting Position | 6367 |
| Ending Position: | 6388 |
| Cell Line: | Huh-7 |
| siRNA Expression Method: | Chemically Synthesized |
| PubMed: | 16872906 |
| Target Object (mRNA,Protein,etc): | RNA |
| Silencing Efficacy : | 98 |
| Structure: |  |
| siRNA sequence matching with Hepatitis C Virus [HCV] reference genome: |  |
| Target mRNA1: | NS5B |
| mRNA1 % inhibition: | 97 |
| RNA % inhibition: | 98 |
| RNA Detection method: | Luciferase Assay |
.
.
.
.
.
.
.
.
.
.
.
.
.